ID: 1075526756

View in Genome Browser
Species Human (GRCh38)
Location 10:123193664-123193686
Sequence GAGGGCCAAACTGAATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075526756_1075526762 7 Left 1075526756 10:123193664-123193686 CCTCCTAATTCAGTTTGGCCCTC No data
Right 1075526762 10:123193694-123193716 TAGAAAAGGATTGTAATTAGAGG No data
1075526756_1075526758 -7 Left 1075526756 10:123193664-123193686 CCTCCTAATTCAGTTTGGCCCTC No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data
1075526756_1075526763 8 Left 1075526756 10:123193664-123193686 CCTCCTAATTCAGTTTGGCCCTC No data
Right 1075526763 10:123193695-123193717 AGAAAAGGATTGTAATTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075526756 Original CRISPR GAGGGCCAAACTGAATTAGG AGG (reversed) Intergenic
No off target data available for this crispr