ID: 1075526758

View in Genome Browser
Species Human (GRCh38)
Location 10:123193680-123193702
Sequence GGCCCTCTTGTTCCTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075526755_1075526758 -6 Left 1075526755 10:123193663-123193685 CCCTCCTAATTCAGTTTGGCCCT No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data
1075526754_1075526758 -5 Left 1075526754 10:123193662-123193684 CCCCTCCTAATTCAGTTTGGCCC No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data
1075526753_1075526758 -4 Left 1075526753 10:123193661-123193683 CCCCCTCCTAATTCAGTTTGGCC No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data
1075526756_1075526758 -7 Left 1075526756 10:123193664-123193686 CCTCCTAATTCAGTTTGGCCCTC No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data
1075526757_1075526758 -10 Left 1075526757 10:123193667-123193689 CCTAATTCAGTTTGGCCCTCTTG No data
Right 1075526758 10:123193680-123193702 GGCCCTCTTGTTCCTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075526758 Original CRISPR GGCCCTCTTGTTCCTAGAAA AGG Intergenic
No off target data available for this crispr