ID: 1075528340

View in Genome Browser
Species Human (GRCh38)
Location 10:123204484-123204506
Sequence GAGGGTAAATTGGATGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075528340_1075528348 7 Left 1075528340 10:123204484-123204506 CCCGCCTCATCCAATTTACCCTC No data
Right 1075528348 10:123204514-123204536 TCTAGGTCAGCCTAGAAAGGAGG No data
1075528340_1075528347 4 Left 1075528340 10:123204484-123204506 CCCGCCTCATCCAATTTACCCTC No data
Right 1075528347 10:123204511-123204533 TTCTCTAGGTCAGCCTAGAAAGG No data
1075528340_1075528344 -10 Left 1075528340 10:123204484-123204506 CCCGCCTCATCCAATTTACCCTC No data
Right 1075528344 10:123204497-123204519 ATTTACCCTCTGTCTTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075528340 Original CRISPR GAGGGTAAATTGGATGAGGC GGG (reversed) Intergenic
No off target data available for this crispr