ID: 1075536348

View in Genome Browser
Species Human (GRCh38)
Location 10:123275324-123275346
Sequence TGTGCCTGGTAGCCGCTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536343_1075536348 11 Left 1075536343 10:123275290-123275312 CCGGCAAACAAGCGGCCCTTTCC No data
Right 1075536348 10:123275324-123275346 TGTGCCTGGTAGCCGCTGCCCGG No data
1075536345_1075536348 -5 Left 1075536345 10:123275306-123275328 CCTTTCCTTTTGCAATTATGTGC No data
Right 1075536348 10:123275324-123275346 TGTGCCTGGTAGCCGCTGCCCGG No data
1075536344_1075536348 -4 Left 1075536344 10:123275305-123275327 CCCTTTCCTTTTGCAATTATGTG No data
Right 1075536348 10:123275324-123275346 TGTGCCTGGTAGCCGCTGCCCGG No data
1075536347_1075536348 -10 Left 1075536347 10:123275311-123275333 CCTTTTGCAATTATGTGCCTGGT No data
Right 1075536348 10:123275324-123275346 TGTGCCTGGTAGCCGCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536348 Original CRISPR TGTGCCTGGTAGCCGCTGCC CGG Intergenic
No off target data available for this crispr