ID: 1075536693

View in Genome Browser
Species Human (GRCh38)
Location 10:123277545-123277567
Sequence CTGGTTCTGCGGGGTTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536687_1075536693 -4 Left 1075536687 10:123277526-123277548 CCAAGGATGAGACCTGCATCTGG No data
Right 1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG No data
1075536685_1075536693 12 Left 1075536685 10:123277510-123277532 CCCACGCTTTTGGAAGCCAAGGA No data
Right 1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG No data
1075536686_1075536693 11 Left 1075536686 10:123277511-123277533 CCACGCTTTTGGAAGCCAAGGAT No data
Right 1075536693 10:123277545-123277567 CTGGTTCTGCGGGGTTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536693 Original CRISPR CTGGTTCTGCGGGGTTTTAT TGG Intergenic
No off target data available for this crispr