ID: 1075536950

View in Genome Browser
Species Human (GRCh38)
Location 10:123279227-123279249
Sequence TGGCAAGAACATTGTTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536950_1075536954 4 Left 1075536950 10:123279227-123279249 CCTGGGAAACAATGTTCTTGCCA No data
Right 1075536954 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
1075536950_1075536959 30 Left 1075536950 10:123279227-123279249 CCTGGGAAACAATGTTCTTGCCA No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data
1075536950_1075536957 26 Left 1075536950 10:123279227-123279249 CCTGGGAAACAATGTTCTTGCCA No data
Right 1075536957 10:123279276-123279298 GTCTCCTCATCTGTGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536950 Original CRISPR TGGCAAGAACATTGTTTCCC AGG (reversed) Intergenic
No off target data available for this crispr