ID: 1075536952

View in Genome Browser
Species Human (GRCh38)
Location 10:123279247-123279269
Sequence TCAGAGAAGGCCTCGGTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536952_1075536957 6 Left 1075536952 10:123279247-123279269 CCACTCACCGAGGCCTTCTCTGA No data
Right 1075536957 10:123279276-123279298 GTCTCCTCATCTGTGAACTGTGG No data
1075536952_1075536960 18 Left 1075536952 10:123279247-123279269 CCACTCACCGAGGCCTTCTCTGA No data
Right 1075536960 10:123279288-123279310 GTGAACTGTGGAAGGTAATGAGG No data
1075536952_1075536959 10 Left 1075536952 10:123279247-123279269 CCACTCACCGAGGCCTTCTCTGA No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data
1075536952_1075536961 30 Left 1075536952 10:123279247-123279269 CCACTCACCGAGGCCTTCTCTGA No data
Right 1075536961 10:123279300-123279322 AGGTAATGAGGCCTAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536952 Original CRISPR TCAGAGAAGGCCTCGGTGAG TGG (reversed) Intergenic
No off target data available for this crispr