ID: 1075536953

View in Genome Browser
Species Human (GRCh38)
Location 10:123279254-123279276
Sequence CCAAGGCTCAGAGAAGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536953_1075536962 24 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536962 10:123279301-123279323 GGTAATGAGGCCTAGCCTGAGGG No data
1075536953_1075536963 25 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536963 10:123279302-123279324 GTAATGAGGCCTAGCCTGAGGGG No data
1075536953_1075536960 11 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536960 10:123279288-123279310 GTGAACTGTGGAAGGTAATGAGG No data
1075536953_1075536961 23 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536961 10:123279300-123279322 AGGTAATGAGGCCTAGCCTGAGG No data
1075536953_1075536957 -1 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536957 10:123279276-123279298 GTCTCCTCATCTGTGAACTGTGG No data
1075536953_1075536959 3 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536953 Original CRISPR CCAAGGCTCAGAGAAGGCCT CGG (reversed) Intergenic
No off target data available for this crispr