ID: 1075536959

View in Genome Browser
Species Human (GRCh38)
Location 10:123279280-123279302
Sequence CCTCATCTGTGAACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075536955_1075536959 -3 Left 1075536955 10:123279260-123279282 CCTTCTCTGAGCCTTGGTCTCCT No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data
1075536952_1075536959 10 Left 1075536952 10:123279247-123279269 CCACTCACCGAGGCCTTCTCTGA No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data
1075536950_1075536959 30 Left 1075536950 10:123279227-123279249 CCTGGGAAACAATGTTCTTGCCA No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data
1075536953_1075536959 3 Left 1075536953 10:123279254-123279276 CCGAGGCCTTCTCTGAGCCTTGG No data
Right 1075536959 10:123279280-123279302 CCTCATCTGTGAACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075536959 Original CRISPR CCTCATCTGTGAACTGTGGA AGG Intergenic
No off target data available for this crispr