ID: 1075538358

View in Genome Browser
Species Human (GRCh38)
Location 10:123290652-123290674
Sequence TTCCCTCATCTCCCTGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075538358_1075538362 23 Left 1075538358 10:123290652-123290674 CCAGGCCCAGGGAGATGAGGGAA No data
Right 1075538362 10:123290698-123290720 CAAGTATTTCATAGTTAAGATGG No data
1075538358_1075538363 26 Left 1075538358 10:123290652-123290674 CCAGGCCCAGGGAGATGAGGGAA No data
Right 1075538363 10:123290701-123290723 GTATTTCATAGTTAAGATGGAGG No data
1075538358_1075538365 28 Left 1075538358 10:123290652-123290674 CCAGGCCCAGGGAGATGAGGGAA No data
Right 1075538365 10:123290703-123290725 ATTTCATAGTTAAGATGGAGGGG No data
1075538358_1075538364 27 Left 1075538358 10:123290652-123290674 CCAGGCCCAGGGAGATGAGGGAA No data
Right 1075538364 10:123290702-123290724 TATTTCATAGTTAAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075538358 Original CRISPR TTCCCTCATCTCCCTGGGCC TGG (reversed) Intergenic
No off target data available for this crispr