ID: 1075540892

View in Genome Browser
Species Human (GRCh38)
Location 10:123312896-123312918
Sequence AACAAAGAAGTGGGTTCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075540888_1075540892 -2 Left 1075540888 10:123312875-123312897 CCATTAGTAATGTCTGGCCACAA No data
Right 1075540892 10:123312896-123312918 AACAAAGAAGTGGGTTCAATAGG No data
1075540884_1075540892 29 Left 1075540884 10:123312844-123312866 CCATAGACTCTCAGTCACATTGG No data
Right 1075540892 10:123312896-123312918 AACAAAGAAGTGGGTTCAATAGG No data
1075540883_1075540892 30 Left 1075540883 10:123312843-123312865 CCCATAGACTCTCAGTCACATTG No data
Right 1075540892 10:123312896-123312918 AACAAAGAAGTGGGTTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075540892 Original CRISPR AACAAAGAAGTGGGTTCAAT AGG Intergenic
No off target data available for this crispr