ID: 1075541240

View in Genome Browser
Species Human (GRCh38)
Location 10:123316317-123316339
Sequence CACCCGGTACACACCATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541240_1075541243 -7 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541243 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG No data
1075541240_1075541246 11 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541246 10:123316351-123316373 AATGGTGCTTTTCCTCCTCATGG No data
1075541240_1075541247 12 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541247 10:123316352-123316374 ATGGTGCTTTTCCTCCTCATGGG No data
1075541240_1075541250 28 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541250 10:123316368-123316390 TCATGGGACTCACTTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541240 Original CRISPR CACCCGGTACACACCATGTC TGG (reversed) Intergenic