ID: 1075541243

View in Genome Browser
Species Human (GRCh38)
Location 10:123316333-123316355
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541240_1075541243 -7 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541243 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541243 Original CRISPR CCGGGTGTTTAGGCCCAGAA TGG Intergenic
No off target data available for this crispr