ID: 1075541246

View in Genome Browser
Species Human (GRCh38)
Location 10:123316351-123316373
Sequence AATGGTGCTTTTCCTCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541242_1075541246 -5 Left 1075541242 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG No data
Right 1075541246 10:123316351-123316373 AATGGTGCTTTTCCTCCTCATGG No data
1075541240_1075541246 11 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541246 10:123316351-123316373 AATGGTGCTTTTCCTCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541246 Original CRISPR AATGGTGCTTTTCCTCCTCA TGG Intergenic