ID: 1075541250

View in Genome Browser
Species Human (GRCh38)
Location 10:123316368-123316390
Sequence TCATGGGACTCACTTTCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541244_1075541250 -1 Left 1075541244 10:123316346-123316368 CCCAGAATGGTGCTTTTCCTCCT No data
Right 1075541250 10:123316368-123316390 TCATGGGACTCACTTTCTAGAGG No data
1075541242_1075541250 12 Left 1075541242 10:123316333-123316355 CCGGGTGTTTAGGCCCAGAATGG No data
Right 1075541250 10:123316368-123316390 TCATGGGACTCACTTTCTAGAGG No data
1075541245_1075541250 -2 Left 1075541245 10:123316347-123316369 CCAGAATGGTGCTTTTCCTCCTC No data
Right 1075541250 10:123316368-123316390 TCATGGGACTCACTTTCTAGAGG No data
1075541240_1075541250 28 Left 1075541240 10:123316317-123316339 CCAGACATGGTGTGTACCGGGTG No data
Right 1075541250 10:123316368-123316390 TCATGGGACTCACTTTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541250 Original CRISPR TCATGGGACTCACTTTCTAG AGG Intergenic