ID: 1075541308

View in Genome Browser
Species Human (GRCh38)
Location 10:123316791-123316813
Sequence CTGTCTTCTGGGCTGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541308_1075541318 5 Left 1075541308 10:123316791-123316813 CCCTCCAACAGCCCAGAAGACAG No data
Right 1075541318 10:123316819-123316841 CAGGCCAGAGAACATTTGGAAGG No data
1075541308_1075541314 1 Left 1075541308 10:123316791-123316813 CCCTCCAACAGCCCAGAAGACAG No data
Right 1075541314 10:123316815-123316837 GCCCCAGGCCAGAGAACATTTGG No data
1075541308_1075541320 30 Left 1075541308 10:123316791-123316813 CCCTCCAACAGCCCAGAAGACAG No data
Right 1075541320 10:123316844-123316866 CATCAGAGCACATGCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541308 Original CRISPR CTGTCTTCTGGGCTGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr