ID: 1075541578

View in Genome Browser
Species Human (GRCh38)
Location 10:123318468-123318490
Sequence ACAGCAGCTCATCCTCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075541574_1075541578 21 Left 1075541574 10:123318424-123318446 CCAGCCTGTGCAGAAAACCAACC No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541573_1075541578 22 Left 1075541573 10:123318423-123318445 CCCAGCCTGTGCAGAAAACCAAC No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541575_1075541578 17 Left 1075541575 10:123318428-123318450 CCTGTGCAGAAAACCAACCATCT No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541572_1075541578 23 Left 1075541572 10:123318422-123318444 CCCCAGCCTGTGCAGAAAACCAA No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541571_1075541578 29 Left 1075541571 10:123318416-123318438 CCTCTACCCCAGCCTGTGCAGAA No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541576_1075541578 4 Left 1075541576 10:123318441-123318463 CCAACCATCTCGAGTATCTGCAG No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data
1075541577_1075541578 0 Left 1075541577 10:123318445-123318467 CCATCTCGAGTATCTGCAGACTA No data
Right 1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075541578 Original CRISPR ACAGCAGCTCATCCTCCTTG TGG Intergenic
No off target data available for this crispr