ID: 1075542608

View in Genome Browser
Species Human (GRCh38)
Location 10:123328205-123328227
Sequence AAATGTATCCTGCAAATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075542602_1075542608 28 Left 1075542602 10:123328154-123328176 CCTGCTGAAAAATGTCTGGAAAA No data
Right 1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG No data
1075542607_1075542608 -8 Left 1075542607 10:123328190-123328212 CCTGGGCAGCTTTGCAAATGTAT No data
Right 1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG No data
1075542606_1075542608 0 Left 1075542606 10:123328182-123328204 CCGCTGCTCCTGGGCAGCTTTGC No data
Right 1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075542608 Original CRISPR AAATGTATCCTGCAAATAAG AGG Intergenic
No off target data available for this crispr