ID: 1075544256

View in Genome Browser
Species Human (GRCh38)
Location 10:123342623-123342645
Sequence CCTGGAGAGTCCCCGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075544252_1075544256 0 Left 1075544252 10:123342600-123342622 CCCTCAACACACATACACTTAAT No data
Right 1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG No data
1075544253_1075544256 -1 Left 1075544253 10:123342601-123342623 CCTCAACACACATACACTTAATC No data
Right 1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG No data
1075544249_1075544256 7 Left 1075544249 10:123342593-123342615 CCTCCCTCCCTCAACACACATAC No data
Right 1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG No data
1075544250_1075544256 4 Left 1075544250 10:123342596-123342618 CCCTCCCTCAACACACATACACT No data
Right 1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG No data
1075544251_1075544256 3 Left 1075544251 10:123342597-123342619 CCTCCCTCAACACACATACACTT No data
Right 1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075544256 Original CRISPR CCTGGAGAGTCCCCGAAGTC AGG Intergenic
No off target data available for this crispr