ID: 1075544413

View in Genome Browser
Species Human (GRCh38)
Location 10:123343547-123343569
Sequence CTCTGGAAACAGATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075544409_1075544413 -2 Left 1075544409 10:123343526-123343548 CCTCATGGGTGAGAGATCTAGCT No data
Right 1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075544413 Original CRISPR CTCTGGAAACAGATGGAGCT GGG Intergenic
No off target data available for this crispr