ID: 1075544881

View in Genome Browser
Species Human (GRCh38)
Location 10:123347559-123347581
Sequence CTTCTAGTGCTGCAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075544875_1075544881 -7 Left 1075544875 10:123347543-123347565 CCCCCCTTGGTGAGGACTTCTAG No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544877_1075544881 -9 Left 1075544877 10:123347545-123347567 CCCCTTGGTGAGGACTTCTAGTG No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544869_1075544881 19 Left 1075544869 10:123347517-123347539 CCCTGTCCTTTCGTTTTGGGGAC No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544870_1075544881 18 Left 1075544870 10:123347518-123347540 CCTGTCCTTTCGTTTTGGGGACT No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544872_1075544881 13 Left 1075544872 10:123347523-123347545 CCTTTCGTTTTGGGGACTGGCCC No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544878_1075544881 -10 Left 1075544878 10:123347546-123347568 CCCTTGGTGAGGACTTCTAGTGC No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data
1075544876_1075544881 -8 Left 1075544876 10:123347544-123347566 CCCCCTTGGTGAGGACTTCTAGT No data
Right 1075544881 10:123347559-123347581 CTTCTAGTGCTGCAGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075544881 Original CRISPR CTTCTAGTGCTGCAGGTATC TGG Intergenic
No off target data available for this crispr