ID: 1075545249

View in Genome Browser
Species Human (GRCh38)
Location 10:123350353-123350375
Sequence TCACGGGTTCCTCCTCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545249_1075545250 -10 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545250 10:123350366-123350388 GAACCCGTGAGCCAGCACAGAGG No data
1075545249_1075545257 19 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545257 10:123350395-123350417 TTGCCTGTGATCTTGTGGCTTGG No data
1075545249_1075545259 22 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545259 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
1075545249_1075545255 14 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545249_1075545260 29 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545249 Original CRISPR TCACGGGTTCCTCCTCCACA AGG (reversed) Intergenic