ID: 1075545251

View in Genome Browser
Species Human (GRCh38)
Location 10:123350369-123350391
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545251_1075545259 6 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545259 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
1075545251_1075545255 -2 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545251_1075545262 19 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545251_1075545261 18 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545261 10:123350410-123350432 TGGCTTGGAGGCAGTAGGACAGG No data
1075545251_1075545257 3 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545257 10:123350395-123350417 TTGCCTGTGATCTTGTGGCTTGG No data
1075545251_1075545260 13 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG 0: 1
1: 0
2: 1
3: 26
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545251 Original CRISPR GGTCCTCTGTGCTGGCTCAC GGG (reversed) Intergenic