ID: 1075545254

View in Genome Browser
Species Human (GRCh38)
Location 10:123350390-123350412
Sequence CCACAAGATCACAGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545254_1075545260 -8 Left 1075545254 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545254_1075545261 -3 Left 1075545254 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
Right 1075545261 10:123350410-123350432 TGGCTTGGAGGCAGTAGGACAGG No data
1075545254_1075545262 -2 Left 1075545254 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545254 Original CRISPR CCACAAGATCACAGGCAAGT GGG (reversed) Intergenic