ID: 1075545255

View in Genome Browser
Species Human (GRCh38)
Location 10:123350390-123350412
Sequence CCCACTTGCCTGTGATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545247_1075545255 18 Left 1075545247 10:123350349-123350371 CCCACCTTGTGGAGGAGGAACCC No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545253_1075545255 -10 Left 1075545253 10:123350377-123350399 CCAGCACAGAGGACCCACTTGCC No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545251_1075545255 -2 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545244_1075545255 28 Left 1075545244 10:123350339-123350361 CCATTGTTAACCCACCTTGTGGA No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545252_1075545255 -3 Left 1075545252 10:123350370-123350392 CCGTGAGCCAGCACAGAGGACCC No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545249_1075545255 14 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
1075545248_1075545255 17 Left 1075545248 10:123350350-123350372 CCACCTTGTGGAGGAGGAACCCG No data
Right 1075545255 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545255 Original CRISPR CCCACTTGCCTGTGATCTTG TGG Intergenic