ID: 1075545256 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:123350391-123350413 |
Sequence | GCCACAAGATCACAGGCAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1075545256_1075545262 | -3 | Left | 1075545256 | 10:123350391-123350413 | CCACTTGCCTGTGATCTTGTGGC | No data | ||
Right | 1075545262 | 10:123350411-123350433 | GGCTTGGAGGCAGTAGGACAGGG | No data | ||||
1075545256_1075545261 | -4 | Left | 1075545256 | 10:123350391-123350413 | CCACTTGCCTGTGATCTTGTGGC | No data | ||
Right | 1075545261 | 10:123350410-123350432 | TGGCTTGGAGGCAGTAGGACAGG | No data | ||||
1075545256_1075545260 | -9 | Left | 1075545256 | 10:123350391-123350413 | CCACTTGCCTGTGATCTTGTGGC | No data | ||
Right | 1075545260 | 10:123350405-123350427 | TCTTGTGGCTTGGAGGCAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1075545256 | Original CRISPR | GCCACAAGATCACAGGCAAG TGG (reversed) | Intergenic | ||