ID: 1075545258

View in Genome Browser
Species Human (GRCh38)
Location 10:123350398-123350420
Sequence CCTCCAAGCCACAAGATCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545258_1075545264 30 Left 1075545258 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
Right 1075545264 10:123350451-123350473 CAACTGAATCCAAAGCCTGTGGG No data
1075545258_1075545262 -10 Left 1075545258 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545258_1075545263 29 Left 1075545258 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
Right 1075545263 10:123350450-123350472 TCAACTGAATCCAAAGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545258 Original CRISPR CCTCCAAGCCACAAGATCAC AGG (reversed) Intergenic