ID: 1075545260

View in Genome Browser
Species Human (GRCh38)
Location 10:123350405-123350427
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545249_1075545260 29 Left 1075545249 10:123350353-123350375 CCTTGTGGAGGAGGAACCCGTGA No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545251_1075545260 13 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545256_1075545260 -9 Left 1075545256 10:123350391-123350413 CCACTTGCCTGTGATCTTGTGGC No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545254_1075545260 -8 Left 1075545254 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545252_1075545260 12 Left 1075545252 10:123350370-123350392 CCGTGAGCCAGCACAGAGGACCC No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data
1075545253_1075545260 5 Left 1075545253 10:123350377-123350399 CCAGCACAGAGGACCCACTTGCC No data
Right 1075545260 10:123350405-123350427 TCTTGTGGCTTGGAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545260 Original CRISPR TCTTGTGGCTTGGAGGCAGT AGG Intergenic