ID: 1075545262

View in Genome Browser
Species Human (GRCh38)
Location 10:123350411-123350433
Sequence GGCTTGGAGGCAGTAGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075545252_1075545262 18 Left 1075545252 10:123350370-123350392 CCGTGAGCCAGCACAGAGGACCC No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545258_1075545262 -10 Left 1075545258 10:123350398-123350420 CCTGTGATCTTGTGGCTTGGAGG No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545253_1075545262 11 Left 1075545253 10:123350377-123350399 CCAGCACAGAGGACCCACTTGCC No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545254_1075545262 -2 Left 1075545254 10:123350390-123350412 CCCACTTGCCTGTGATCTTGTGG No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545251_1075545262 19 Left 1075545251 10:123350369-123350391 CCCGTGAGCCAGCACAGAGGACC No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data
1075545256_1075545262 -3 Left 1075545256 10:123350391-123350413 CCACTTGCCTGTGATCTTGTGGC No data
Right 1075545262 10:123350411-123350433 GGCTTGGAGGCAGTAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075545262 Original CRISPR GGCTTGGAGGCAGTAGGACA GGG Intergenic