ID: 1075548327

View in Genome Browser
Species Human (GRCh38)
Location 10:123373126-123373148
Sequence GGTTATATTGGAGGAAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075548327_1075548337 1 Left 1075548327 10:123373126-123373148 CCCCCTCTTCCTCCAATATAACC No data
Right 1075548337 10:123373150-123373172 GTAACCAGGAATCGTGTTATGGG No data
1075548327_1075548336 0 Left 1075548327 10:123373126-123373148 CCCCCTCTTCCTCCAATATAACC No data
Right 1075548336 10:123373149-123373171 CGTAACCAGGAATCGTGTTATGG No data
1075548327_1075548340 20 Left 1075548327 10:123373126-123373148 CCCCCTCTTCCTCCAATATAACC No data
Right 1075548340 10:123373169-123373191 TGGGTTAGAGGCATTTTCCCAGG No data
1075548327_1075548339 8 Left 1075548327 10:123373126-123373148 CCCCCTCTTCCTCCAATATAACC No data
Right 1075548339 10:123373157-123373179 GGAATCGTGTTATGGGTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075548327 Original CRISPR GGTTATATTGGAGGAAGAGG GGG (reversed) Intergenic
No off target data available for this crispr