ID: 1075550969

View in Genome Browser
Species Human (GRCh38)
Location 10:123391953-123391975
Sequence GTCTGGCAGCACCACGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075550955_1075550969 27 Left 1075550955 10:123391903-123391925 CCCCCCATATCTTAGCCAGCACG No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550963_1075550969 -2 Left 1075550963 10:123391932-123391954 CCAGATGTACCCAAGACAGTTGT No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550957_1075550969 25 Left 1075550957 10:123391905-123391927 CCCCATATCTTAGCCAGCACGTG No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550958_1075550969 24 Left 1075550958 10:123391906-123391928 CCCATATCTTAGCCAGCACGTGG No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550962_1075550969 12 Left 1075550962 10:123391918-123391940 CCAGCACGTGGTGGCCAGATGTA No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550956_1075550969 26 Left 1075550956 10:123391904-123391926 CCCCCATATCTTAGCCAGCACGT No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data
1075550960_1075550969 23 Left 1075550960 10:123391907-123391929 CCATATCTTAGCCAGCACGTGGT No data
Right 1075550969 10:123391953-123391975 GTCTGGCAGCACCACGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075550969 Original CRISPR GTCTGGCAGCACCACGGGAC TGG Intergenic
No off target data available for this crispr