ID: 1075559156

View in Genome Browser
Species Human (GRCh38)
Location 10:123456097-123456119
Sequence GCTTCTTGTGTTAGACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075559156_1075559164 30 Left 1075559156 10:123456097-123456119 CCAGGATGTCTAACACAAGAAGC No data
Right 1075559164 10:123456150-123456172 CCAGAGGCTGTCATGTGACCAGG No data
1075559156_1075559161 14 Left 1075559156 10:123456097-123456119 CCAGGATGTCTAACACAAGAAGC No data
Right 1075559161 10:123456134-123456156 CTACTCTCCGCTGCTACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075559156 Original CRISPR GCTTCTTGTGTTAGACATCC TGG (reversed) Intergenic
No off target data available for this crispr