ID: 1075563063

View in Genome Browser
Species Human (GRCh38)
Location 10:123482403-123482425
Sequence TGGGTTTAATCCCAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075563054_1075563063 24 Left 1075563054 10:123482356-123482378 CCACATGATTTCTTGGGAAAAGC No data
Right 1075563063 10:123482403-123482425 TGGGTTTAATCCCAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075563063 Original CRISPR TGGGTTTAATCCCAGCTGGG TGG Intergenic
No off target data available for this crispr