ID: 1075571737

View in Genome Browser
Species Human (GRCh38)
Location 10:123551361-123551383
Sequence TCTGCTCAAACATCACTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571737_1075571744 22 Left 1075571737 10:123551361-123551383 CCCAACAGTGATGTTTGAGCAGA No data
Right 1075571744 10:123551406-123551428 GAGCCACGCCATGTTCCGAGGGG No data
1075571737_1075571742 20 Left 1075571737 10:123551361-123551383 CCCAACAGTGATGTTTGAGCAGA No data
Right 1075571742 10:123551404-123551426 GTGAGCCACGCCATGTTCCGAGG No data
1075571737_1075571743 21 Left 1075571737 10:123551361-123551383 CCCAACAGTGATGTTTGAGCAGA No data
Right 1075571743 10:123551405-123551427 TGAGCCACGCCATGTTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571737 Original CRISPR TCTGCTCAAACATCACTGTT GGG (reversed) Intergenic
No off target data available for this crispr