ID: 1075571741

View in Genome Browser
Species Human (GRCh38)
Location 10:123551386-123551408
Sequence CTCACTCTTGTACATCCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571741_1075571749 14 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571749 10:123551423-123551445 GAGGGGAGAGCATGCCAGGCAGG No data
1075571741_1075571750 15 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571750 10:123551424-123551446 AGGGGAGAGCATGCCAGGCAGGG No data
1075571741_1075571754 24 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571754 10:123551433-123551455 CATGCCAGGCAGGGATGGGGAGG No data
1075571741_1075571753 21 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571753 10:123551430-123551452 GAGCATGCCAGGCAGGGATGGGG No data
1075571741_1075571742 -5 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571742 10:123551404-123551426 GTGAGCCACGCCATGTTCCGAGG No data
1075571741_1075571744 -3 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571744 10:123551406-123551428 GAGCCACGCCATGTTCCGAGGGG No data
1075571741_1075571751 19 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571751 10:123551428-123551450 GAGAGCATGCCAGGCAGGGATGG No data
1075571741_1075571747 10 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571747 10:123551419-123551441 TTCCGAGGGGAGAGCATGCCAGG No data
1075571741_1075571752 20 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571752 10:123551429-123551451 AGAGCATGCCAGGCAGGGATGGG No data
1075571741_1075571743 -4 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571743 10:123551405-123551427 TGAGCCACGCCATGTTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571741 Original CRISPR CTCACTCTTGTACATCCTTC CGG (reversed) Intergenic
No off target data available for this crispr