ID: 1075571742

View in Genome Browser
Species Human (GRCh38)
Location 10:123551404-123551426
Sequence GTGAGCCACGCCATGTTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571741_1075571742 -5 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571742 10:123551404-123551426 GTGAGCCACGCCATGTTCCGAGG No data
1075571738_1075571742 19 Left 1075571738 10:123551362-123551384 CCAACAGTGATGTTTGAGCAGAG No data
Right 1075571742 10:123551404-123551426 GTGAGCCACGCCATGTTCCGAGG No data
1075571737_1075571742 20 Left 1075571737 10:123551361-123551383 CCCAACAGTGATGTTTGAGCAGA No data
Right 1075571742 10:123551404-123551426 GTGAGCCACGCCATGTTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571742 Original CRISPR GTGAGCCACGCCATGTTCCG AGG Intergenic
No off target data available for this crispr