ID: 1075571745

View in Genome Browser
Species Human (GRCh38)
Location 10:123551409-123551431
Sequence TCTCCCCTCGGAACATGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571745_1075571756 10 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571756 10:123551442-123551464 CAGGGATGGGGAGGATCAGCCGG No data
1075571745_1075571758 17 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571758 10:123551449-123551471 GGGGAGGATCAGCCGGGCAAAGG No data
1075571745_1075571751 -4 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571751 10:123551428-123551450 GAGAGCATGCCAGGCAGGGATGG No data
1075571745_1075571750 -8 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571750 10:123551424-123551446 AGGGGAGAGCATGCCAGGCAGGG No data
1075571745_1075571749 -9 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571749 10:123551423-123551445 GAGGGGAGAGCATGCCAGGCAGG No data
1075571745_1075571757 11 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571757 10:123551443-123551465 AGGGATGGGGAGGATCAGCCGGG No data
1075571745_1075571754 1 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571754 10:123551433-123551455 CATGCCAGGCAGGGATGGGGAGG No data
1075571745_1075571759 28 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571759 10:123551460-123551482 GCCGGGCAAAGGCCATGCAGAGG No data
1075571745_1075571761 29 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571761 10:123551461-123551483 CCGGGCAAAGGCCATGCAGAGGG No data
1075571745_1075571753 -2 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571753 10:123551430-123551452 GAGCATGCCAGGCAGGGATGGGG No data
1075571745_1075571752 -3 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571752 10:123551429-123551451 AGAGCATGCCAGGCAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571745 Original CRISPR TCTCCCCTCGGAACATGGCG TGG (reversed) Intergenic
No off target data available for this crispr