ID: 1075571747

View in Genome Browser
Species Human (GRCh38)
Location 10:123551419-123551441
Sequence TTCCGAGGGGAGAGCATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571741_1075571747 10 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571747 10:123551419-123551441 TTCCGAGGGGAGAGCATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571747 Original CRISPR TTCCGAGGGGAGAGCATGCC AGG Intergenic
No off target data available for this crispr