ID: 1075571752

View in Genome Browser
Species Human (GRCh38)
Location 10:123551429-123551451
Sequence AGAGCATGCCAGGCAGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075571746_1075571752 -8 Left 1075571746 10:123551414-123551436 CCATGTTCCGAGGGGAGAGCATG No data
Right 1075571752 10:123551429-123551451 AGAGCATGCCAGGCAGGGATGGG No data
1075571741_1075571752 20 Left 1075571741 10:123551386-123551408 CCGGAAGGATGTACAAGAGTGAG No data
Right 1075571752 10:123551429-123551451 AGAGCATGCCAGGCAGGGATGGG No data
1075571745_1075571752 -3 Left 1075571745 10:123551409-123551431 CCACGCCATGTTCCGAGGGGAGA No data
Right 1075571752 10:123551429-123551451 AGAGCATGCCAGGCAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075571752 Original CRISPR AGAGCATGCCAGGCAGGGAT GGG Intergenic
No off target data available for this crispr