ID: 1075572357

View in Genome Browser
Species Human (GRCh38)
Location 10:123555625-123555647
Sequence GTCCACCTGGCCCACGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075572357_1075572365 8 Left 1075572357 10:123555625-123555647 CCCCAACCGTGGGCCAGGTGGAC No data
Right 1075572365 10:123555656-123555678 CTTCTCATGGTGGATTATTTTGG No data
1075572357_1075572363 -2 Left 1075572357 10:123555625-123555647 CCCCAACCGTGGGCCAGGTGGAC No data
Right 1075572363 10:123555646-123555668 ACTTTGCTGCCTTCTCATGGTGG No data
1075572357_1075572362 -5 Left 1075572357 10:123555625-123555647 CCCCAACCGTGGGCCAGGTGGAC No data
Right 1075572362 10:123555643-123555665 TGGACTTTGCTGCCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075572357 Original CRISPR GTCCACCTGGCCCACGGTTG GGG (reversed) Intergenic
No off target data available for this crispr