ID: 1075573134

View in Genome Browser
Species Human (GRCh38)
Location 10:123559464-123559486
Sequence TGTCCAAGAAGGACACCGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075573127_1075573134 -4 Left 1075573127 10:123559445-123559467 CCCCACAATACCCAGGCTGTGTC No data
Right 1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG No data
1075573125_1075573134 6 Left 1075573125 10:123559435-123559457 CCAGGCAAGGCCCCACAATACCC No data
Right 1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG No data
1075573124_1075573134 18 Left 1075573124 10:123559423-123559445 CCGATTCATAAGCCAGGCAAGGC No data
Right 1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG No data
1075573128_1075573134 -5 Left 1075573128 10:123559446-123559468 CCCACAATACCCAGGCTGTGTCC No data
Right 1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG No data
1075573129_1075573134 -6 Left 1075573129 10:123559447-123559469 CCACAATACCCAGGCTGTGTCCA No data
Right 1075573134 10:123559464-123559486 TGTCCAAGAAGGACACCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075573134 Original CRISPR TGTCCAAGAAGGACACCGAC GGG Intergenic
No off target data available for this crispr