ID: 1075575853

View in Genome Browser
Species Human (GRCh38)
Location 10:123576972-123576994
Sequence CAGAGTGAACAGAATGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075575847_1075575853 14 Left 1075575847 10:123576935-123576957 CCACTTGATGAGCTGAAAATGGG No data
Right 1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG No data
1075575845_1075575853 15 Left 1075575845 10:123576934-123576956 CCCACTTGATGAGCTGAAAATGG No data
Right 1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075575853 Original CRISPR CAGAGTGAACAGAATGAGAG GGG Intergenic
No off target data available for this crispr