ID: 1075576869

View in Genome Browser
Species Human (GRCh38)
Location 10:123584157-123584179
Sequence ACGGAGCCACCCCTGGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075576869_1075576875 -1 Left 1075576869 10:123584157-123584179 CCGTTCTCCAGGGGTGGCTCCGT No data
Right 1075576875 10:123584179-123584201 TTTTTGCCTCTGGGCAGAGTGGG No data
1075576869_1075576877 26 Left 1075576869 10:123584157-123584179 CCGTTCTCCAGGGGTGGCTCCGT No data
Right 1075576877 10:123584206-123584228 TCCTGTCCTGTTCTTCAACATGG No data
1075576869_1075576872 -10 Left 1075576869 10:123584157-123584179 CCGTTCTCCAGGGGTGGCTCCGT No data
Right 1075576872 10:123584170-123584192 GTGGCTCCGTTTTTGCCTCTGGG No data
1075576869_1075576874 -2 Left 1075576869 10:123584157-123584179 CCGTTCTCCAGGGGTGGCTCCGT No data
Right 1075576874 10:123584178-123584200 GTTTTTGCCTCTGGGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075576869 Original CRISPR ACGGAGCCACCCCTGGAGAA CGG (reversed) Intergenic
No off target data available for this crispr