ID: 1075579103

View in Genome Browser
Species Human (GRCh38)
Location 10:123603431-123603453
Sequence CGGGCTGATGCCATTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579099_1075579103 -1 Left 1075579099 10:123603409-123603431 CCATCTCTGTCACTGCTGGGAAC No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579095_1075579103 13 Left 1075579095 10:123603395-123603417 CCAGCCTCATCAGTCCATCTCTG No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579091_1075579103 17 Left 1075579091 10:123603391-123603413 CCCCCCAGCCTCATCAGTCCATC No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579094_1075579103 14 Left 1075579094 10:123603394-123603416 CCCAGCCTCATCAGTCCATCTCT No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579096_1075579103 9 Left 1075579096 10:123603399-123603421 CCTCATCAGTCCATCTCTGTCAC No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579092_1075579103 16 Left 1075579092 10:123603392-123603414 CCCCCAGCCTCATCAGTCCATCT No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data
1075579093_1075579103 15 Left 1075579093 10:123603393-123603415 CCCCAGCCTCATCAGTCCATCTC No data
Right 1075579103 10:123603431-123603453 CGGGCTGATGCCATTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579103 Original CRISPR CGGGCTGATGCCATTTCCCT GGG Intergenic
No off target data available for this crispr