ID: 1075579361

View in Genome Browser
Species Human (GRCh38)
Location 10:123605224-123605246
Sequence CTTTCAAGGCTTAAAGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579361_1075579363 7 Left 1075579361 10:123605224-123605246 CCAAACACTTTAAGCCTTGAAAG No data
Right 1075579363 10:123605254-123605276 ACTGTGAATTGAATCACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579361 Original CRISPR CTTTCAAGGCTTAAAGTGTT TGG (reversed) Intergenic
No off target data available for this crispr