ID: 1075579876

View in Genome Browser
Species Human (GRCh38)
Location 10:123609392-123609414
Sequence AGTAGCAGCTGCTAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579876_1075579887 17 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579887 10:123609432-123609454 CACTACTGGAGGGCTTTCGAGGG No data
1075579876_1075579883 3 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579876_1075579885 7 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579885 10:123609422-123609444 TTCGACTGGGCACTACTGGAGGG No data
1075579876_1075579882 -6 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579882 10:123609409-123609431 GCTACTGCTTCTCTTCGACTGGG No data
1075579876_1075579881 -7 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579881 10:123609408-123609430 TGCTACTGCTTCTCTTCGACTGG No data
1075579876_1075579886 16 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579886 10:123609431-123609453 GCACTACTGGAGGGCTTTCGAGG No data
1075579876_1075579884 6 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579884 10:123609421-123609443 CTTCGACTGGGCACTACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579876 Original CRISPR AGTAGCAGCTGCTAGGGGCT GGG (reversed) Intergenic