ID: 1075579879

View in Genome Browser
Species Human (GRCh38)
Location 10:123609398-123609420
Sequence AGAAGCAGTAGCAGCTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579879_1075579885 1 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579885 10:123609422-123609444 TTCGACTGGGCACTACTGGAGGG No data
1075579879_1075579888 29 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579888 10:123609450-123609472 GAGGGTCTCTCACTGCCCCCAGG No data
1075579879_1075579884 0 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579884 10:123609421-123609443 CTTCGACTGGGCACTACTGGAGG No data
1075579879_1075579886 10 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579886 10:123609431-123609453 GCACTACTGGAGGGCTTTCGAGG No data
1075579879_1075579887 11 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579887 10:123609432-123609454 CACTACTGGAGGGCTTTCGAGGG No data
1075579879_1075579883 -3 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579879 Original CRISPR AGAAGCAGTAGCAGCTGCTA GGG (reversed) Intergenic