ID: 1075579880

View in Genome Browser
Species Human (GRCh38)
Location 10:123609399-123609421
Sequence GAGAAGCAGTAGCAGCTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579880_1075579884 -1 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579884 10:123609421-123609443 CTTCGACTGGGCACTACTGGAGG No data
1075579880_1075579888 28 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579888 10:123609450-123609472 GAGGGTCTCTCACTGCCCCCAGG No data
1075579880_1075579883 -4 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579880_1075579887 10 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579887 10:123609432-123609454 CACTACTGGAGGGCTTTCGAGGG No data
1075579880_1075579885 0 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579885 10:123609422-123609444 TTCGACTGGGCACTACTGGAGGG No data
1075579880_1075579886 9 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579886 10:123609431-123609453 GCACTACTGGAGGGCTTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579880 Original CRISPR GAGAAGCAGTAGCAGCTGCT AGG (reversed) Intergenic