ID: 1075579883

View in Genome Browser
Species Human (GRCh38)
Location 10:123609418-123609440
Sequence TCTCTTCGACTGGGCACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579878_1075579883 -2 Left 1075579878 10:123609397-123609419 CCCCTAGCAGCTGCTACTGCTTC No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579876_1075579883 3 Left 1075579876 10:123609392-123609414 CCCAGCCCCTAGCAGCTGCTACT No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579877_1075579883 2 Left 1075579877 10:123609393-123609415 CCAGCCCCTAGCAGCTGCTACTG No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579879_1075579883 -3 Left 1075579879 10:123609398-123609420 CCCTAGCAGCTGCTACTGCTTCT No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data
1075579880_1075579883 -4 Left 1075579880 10:123609399-123609421 CCTAGCAGCTGCTACTGCTTCTC No data
Right 1075579883 10:123609418-123609440 TCTCTTCGACTGGGCACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579883 Original CRISPR TCTCTTCGACTGGGCACTAC TGG Intergenic