ID: 1075579889

View in Genome Browser
Species Human (GRCh38)
Location 10:123609465-123609487
Sequence GTACTCACACGAAAGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075579889_1075579894 -7 Left 1075579889 10:123609465-123609487 CCCCCAGGCTTTCGTGTGAGTAC No data
Right 1075579894 10:123609481-123609503 TGAGTACCCAGCATGGCCTGTGG No data
1075579889_1075579895 -2 Left 1075579889 10:123609465-123609487 CCCCCAGGCTTTCGTGTGAGTAC No data
Right 1075579895 10:123609486-123609508 ACCCAGCATGGCCTGTGGAGAGG No data
1075579889_1075579900 16 Left 1075579889 10:123609465-123609487 CCCCCAGGCTTTCGTGTGAGTAC No data
Right 1075579900 10:123609504-123609526 AGAGGACCGTGCACCCATGTGGG No data
1075579889_1075579899 15 Left 1075579889 10:123609465-123609487 CCCCCAGGCTTTCGTGTGAGTAC No data
Right 1075579899 10:123609503-123609525 GAGAGGACCGTGCACCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075579889 Original CRISPR GTACTCACACGAAAGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr